Foxb2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGGTGTTGGTGCATTCTTAG and TAGGAACTCTTCCCTGGCCG, which resulted in a 1274 bp deletion beginning at Chromosome 19 position 16,872,358 bp and ending after 16,873,631 bp (GRCm38/mm10). This mutation deletes 1274 bp of ENSMUSE00000462680 (exon 1) and is predicted to cause a change of amino acid sequence after residue 3 and truncation 33 amino acids later. (J:188991)