Cldn23^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCTACAGGTCGGAGTCACA and GACGCCGGTGGTGATGACGC, which resulted in a 860 bp deletion beginning at Chromosome 8 position 35,825,454 bp and ending after 35,826,313 bp (GRCm38/mm10). This mutation deletes 860 bp of ENSMUSE00000448200 (exon 1) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 18 amino acids later. (J:188991)