Dzip1l^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTAGATCCCCCAGACAGCG and CTACAGATGAGGCTACAGGG, which resulted in a 390 bp deletion beginning at Chromosome 9 position 99,639,764 bp and ending after 99,640,153 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000219920 (exon 3) and 305 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 167 and early truncation 41 amino acids later. (J:188991)