This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAATTGGCTGGGAAGCGCA and GGCAAAATGTATCTGCGCTG, which resulted in a 5911 bp deletion beginning at Chromosome 15 position 78,913,713 bp and ending after 78,919,623 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000557887, ENSMUSE00000557885 (exons 1,2) and 3910 bp of flanking intronic sequence including the transcription start, splice acceptor and donor and is predicted to generate a null allele. (J:188991)