This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAACGGCTAGAAGTAGGGCA and TCCCATGACAAGACTCCAGA, which resulted in a 1561 bp deletion beginning at Chromosome 7 position 28,367,390 bp and ending after 28,368,950 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001262284 to ENSMUSE00001304994(exons 5-9) and 957 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 156 and early truncation 5 amino acids later. (J:188991)