Plbd2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACATGCATCAACCCCACTGA and AGCAGTTGCCTGCCACACGA, which resulted in a 324 bp deletion beginning at Chromosome 5 position 120,498,915 bp and ending after 120,499,238 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254826 (exon 2) and 230 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 102 and early truncation 6 amino acids later. (J:188991)