Rcc1^em1(IMPC)Tcp

This allele from project TCPR1319 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes single guide RNAs having spacer sequences of AGCCAGTAAATAATCTCGAA and AGTCTGCGAACTGTGTTGGG and 2 single-strand oligonucleotides to introduce loxP sites. The loxP sites were not incorporated into this allele instead a 815-bp Chr4: 132335167 to 132335981_insGACTCCTG. (J:265051)