Aftph^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAAAACAGATACTATCCA and GGTTTTTGAGACTAATGCCC, which resulted in a 2354 bp deletion beginning at Chromosome 11 position 20,725,445 bp and ending after 20,727,798 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000494059 (exon 2) and 399 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to generate a null allele. (J:188991)