Grxcr1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGAGGTGACCATGCTAAGA and CAATTTGACCAAAGTGTTGC, which resulted in a 378 bp deletion beginning at Chromosome 5 position 68,031,909 bp and ending after 68,032,286 bp (GRCm38/mm10). This mutation deletes 378 bp of ENSMUSE00000598905 (exon 1) resulting in a change of amino acid sequence after residue 7, a loss of 126 amino acids and remains in frame. (J:188991)