Ddx31^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGATAGCGGAGTTATTATG and AATCCAGTCTGCATACAAGC, which resulted in a 635 bp deletion beginning at Chromosome 2 position 28,845,670 bp and ending after 28,846,304 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001276560 (exon 4) and 591 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 114 and early truncation 24 amino acids later. (J:188991)