This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTTCCTAGAACCTATAGT and TGGCTAGCAGAAATAGGCCA, which resulted in a 636 bp deletion beginning at Chromosome 18 position 61,009,209 bp and ending after 61,009,844 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000143841 (exon 2) and 452 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 53 amino acids later. (J:188991)