This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGCTCCTCCCCTGTCCGCG and TTTTGGATCAGACCAACTCG, which resulted in a 769 bp deletion beginning at Chromosome 9 position 37,516,948 bp and ending after 37,517,716 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000352073 (exon 2) and 513 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 170 and early truncation 9 amino acids later. (J:188991)