This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTGTGTAGGAACACAGAG and TCTGCCAAAGGACTTCTAGG, which resulted in a 525 bp deletion beginning at Chromosome 10 position 42,923,773 bp and ending after 42,924,297 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001277490 (exon 4) and 395 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 52 and early truncation 4 amino acids later. (J:188991)