Zbtb37^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTAGGATCAGTAATTGCCA and AGTTCAAACATCCCTACAAA, which resulted in a 1328 bp deletion beginning at Chromosome 1 position 161,031,517 bp and ending after 161,032,844 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000947438 (exon 3) and 368 bp of flanking intronic sequence including the splice acceptor and donor and start site and is predicted to generate a null allele. (J:188991)