This allele from project TCPR0233 was generated at The Centre for Phenogenomics by injecting Cas9 ribnucleoprotein complexes with a single guide RNA having spacer sequences TCATGTCCCTCAGACGGCAC along with a single-strand oligonucleotide repair template. Homology-directed repair resulted in c.308G>A at Chromosome 10 positive strand 84632459 bp (GRCm38) and is predicted to cause p.R103H. (J:200814)