This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATCAGTGCGGAGATGAGGG and TAGACCTGAGGCAAATGCTG, which resulted in a 483 bp deletion beginning at Chromosome 1 position 191,069,888 bp and ending after 191,070,370 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000461366 (exon 3) and 352 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104 and early truncation 14 amino acids later. (J:188991)