Frmd3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAAGCGGCAAAAGATCACAG and CTCCACAGCCTACTTCCTGG, which resulted in a 227 bp deletion beginning at Chromosome 4 position 74,119,755 bp and ending after 74,119,981 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000398544 (exon 4) and 148 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and early truncation 73 amino acids later. (J:188991)