Wnk3^em3(IMPC)Tcp

This allele from project TCPR0565 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and a single guide RNA with a spacer sequence of ATTTCAGCGGGGTCGGTTCC along with a lacZ target vector. The lacZ was not incorporated into the allele and instead non-homologous end-joining repair resulted in an indel at ChrX:151294546-151294547_delGT (GRCm38). (J:200814)