This allele from project TCPR1187 was generated at The Centre for Phenogenomics by injecting Cpf1 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of CCAGCATAACTCCTGTCAAGTAA targeting the 5' side and AGTAAAGAAATTAGTGTGCTCTA targeting the 3' side of a critical exon. This resulted in a 242-bp deletion Chr15:58794295 to 58794536 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)