This allele from project TCPR0804 was generated at The Centre for Phenogenomics by electroporating Cas9 ribnucleoprotein complexes with two guide RNAs having spacer sequences of GGCGTGCTGAACCGCATCAA targeting the 5' side and TGACAGAATGCATTTCCACC targeting the 3' side of exons ENSMUSE00000658353, ENSMUSE00001018647, ENSMUSE00000975105, and ENSMUSE00000455244 resulting in a 5,788-bp deletion of Chr17 from 6955245 to 6961032 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 33 and early truncation 74 amino acids later (p.I33Rfs*76). (J:200814)