This allele from project TCPR0622 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GTAGCATGGCATACCATTGA and AGTTCCAAATCCTACCTAAC targeting the 5' side and AATGCCGTGCTCCAGAGAAT and TCTTGCGTCAACCCCTACTG targeting the 3' side of exon ENSMUSE00000891956 resulting in a 321-bp del of Chr10 from 11160323 to 11160643, and 3-bp del of Chr10 from 11160716 to 11160718 (GRCm38). (J:200814)