This allele from project TCPR1155 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs with spacer sequences of TTCTTGTAGCAACTGATGGC and GAGGGAATACCTTTCACTAT targeting the 5' side and TAGTGTCGTGTGGAGACGTT and ATGGAAGCAGGTCGTATTAC targeting the 3' side of a critical exon. This resulted in a 673-bp del Chr4:46498890 to 46499562 with an insertion of 152-bp resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (GRCm38) (J:200814)