This allele from project TCPR861was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs single guide RNA(s) with spacer sequences of GTAATACCAGTTCTTAACAA and TCTCTTTAGACTACCAACGG targeting the 5' side and AGACGGCAAAAGTGCTGGAT and TTCACCGTTTGCAATTTTGA targeting the 3' side leading to a 737-bp deletion from ChrX:153382331 to 153383067; 1-bp deletion ChrX:153383168_delT resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). (J:200814)