This allele from project TCPR858 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNAs with spacer sequences of AGGACGGCTTCGTAGGCCAG and CCGGAAAACCTGCAGACATG targeting the 5' side and CTAGGAACGAATCTCAGAAC and GTTACTTACCCATGAGGCTT targeting the 3' side leading to a 1-bp deletion Chr11:51835394_delG, 271-bp deletion Chr11:51835470 to 51835740, and a 7-bp deletion Chr11:51835782 to 51835788 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). (J:200814)