This allele from project TCPR858 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of ATGTTCTCCGGACAAAAATG and GTTCCATCAGCGACATAGGC targeting the 5' side and ACATTGCTAGTTCTCGATGC and GCCACTGACCTCCAGAATAT targeting the 3' side leading to a 1597-bp deletion from Chr4:95991796 to 95993392; 10-bp deletion Chr4: 95991707 to 95991716 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)