This allele from project TCPR0415 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and single guide RNA(s) with spacer sequences of AGCACACAAGCTTGATAAAC and GTGTAGGACTGTCTGCATGC targeting the 5' side and GTTCTACTCATGCCTTCCAA and ATAGTAATGGCCAAACGAGA targeting the 3' side of exons ENSMUSE00000272786, ENSMUSE00000272778, and ENSMUSE00000471272 (exons 9-11) resulting in a 1 bp insT at Chr10:128115888, and a 1148 bp deletion of Chr10 from 128115921 to 128117068 (GRCm38). (J:200814)