This allele from project TCPR0357 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequence of GCAAGACGCGCCTGGCCAAG targeting the 5' side and GATCGAGGAGGTGCACGCCG targeting the 3' side of exon ENSMUSE00000286435. This mutation is predicted to cause a frameshift with the amino acid changes after residue 20 and early truncation 46 amino acids later (p.Y20S*fs48). (J:200814)