Adamtsl3^em2(IMPC)Tcp

This allele from project TCPR837 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with 4 single guide RNA(s) with spacer sequences of CACTTTAATCTAAGGCAAGA and GATTGCTGTAGGGCCATTGC targeting the 5' side and GTGATACCTACAGCATTCGG and GGTAGGACTTGTCTAAACAC targeting the 3' side of exon ENSMUSE00000591449 resulting in a 218-bp deletion Chr7:82575906 to 82576123_insTGTGGTGCA and 21-bp deletion Chr7:82576215 to 82576235_insA (GRCm38). (J:200814)