Acad10^em2(IMPC)Tcp

This allele from project TCPR0809 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with 4 single guide RNAs having spacer sequences of CCCGCCATTCCCACAGTATG and TCCTATAACGGGAAGCGTTC targeting the 5' side and ACCCACTCCACCGGTAGGGA and GTGCTCTTACGGATCTGTAA targeting the 3' side of exon ENSMUSE00001224898 and ENSMUSE00001296632 resulting in a 1,529-bp deletion Chr5:121646600 to 121648128 (GRCm38). (J:200814)