Spa17^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGACACACTTCTCAAAACTT and TTACTTATGTCTACAGCACT, which resulted in a 241 bp deletion beginning at Chromosome 9 position 37,607,588 bp and ending after 37,607,828 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000216909 (exon 3) and 170 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 5 amino acids later. (J:188991)