This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAATCAATCGTAACAGTGAA and GTAATCATTAACTAACATAA, which resulted in a 424 bp deletion beginning at Chromosome 3 position 30,608,751 bp and ending after 30,609,174 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000399042 (exon 4) and 264 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 354 and early truncation 22 amino acids later. (J:188991)