This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCCGTGTCCGTTTTCCCC and GCGTGTGTGTTCTCATAACT, which resulted in a 471 bp deletion beginning at Chromosome 4 position 138,834,740 bp and ending after 138,835,210 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000402801 (exon 6) and 37 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and truncation 68 amino acids later by read through after exon 5. (J:188991)