This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCCTAGTCATTTCCAGGCAT and GAGCAAGCGTTCCCAACATG, which resulted in a 519 bp deletion beginning at Chromosome 9 position 58,363,515 bp and ending after 58,364,033 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000253955 (exon 4) and 424 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 90 and early truncation 8 amino acids later. (J:188991)