Rcan3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCGAGTGTGAACTCAGAC and TTAACGGGAGACCTGCTAAG, which resulted in a 2462 bp deletion beginning at Chromosome 4 position 135,418,238 bp and ending after 135,420,699 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000182355 and ENSMUSE00000264256 (exons 3 and 4) and 2106 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 65 and early truncation 50 amino acids later. (J:188991)