Zfp52^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGTTCAACGGTGTGCTACA and TTTGTAAGTACTGGCCCTAT, which resulted in a 213 bp deletion beginning at Chromosome 17 position 21,557,103 bp and ending after 21,557,315 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000970551 (exon 4) and 86 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 10 and early truncation 12 amino acids later. (J:188991)