Dydc2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTCAGCCTCTATCAGCCAG and AACTCGCTTTAGGAAAAGAA, which resulted in a 970 bp deletion beginning at Chromosome 14 position 41,061,848 bp and ending after 41,062,817 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000120891 and ENSMUSE00000120893 (exons 2 and 3) and 691 bp of flanking intronic sequence including the translation start, splice acceptor and donor and is predicted to generate a null allele. (J:188991)