This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCCGTGACTCTAGTGCCATT and CTACTATTCGTAAATAGCCC, which resulted in a 199 bp deletion beginning at Chromosome X position 134,266,210 bp and ending after 134,266,408 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001222478 (exon 3) and 143 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 73 and early truncation 27 amino acids later. (J:188991)