Hspb8^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTGAACTCTCATACCAAAA and ATATCCGGAATGGTGCCCAG, which resulted in a 216 bp deletion beginning at Chromosome 5 position 116,415,300 bp and ending after 116,415,515 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001257375 (exon 2) and 152 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 123 and stop 82 amino acids later by read through into the 3UTR. (J:188991)