Atp13a3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGCTCCTTTACTTCACAT and TATAGTCATGGAATAAGACT, which resulted in a 423 bp deletion beginning at Chromosome 16 position 30,356,957 bp and ending after 30,357,379 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000393476 (exon 8) and 353 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 183 and early truncation 25 amino acids later. (J:188991)