Zmat4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTAATATACATTTATGCAG and GGTGCCATTCAAAACCCACA, which resulted in a 428 bp deletion beginning at Chromosome 8 position 23,901,871 bp and ending after 23,902,298 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000256234 (exon 4) and 271 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 64 and early truncation 3 amino acids later. There is a 6 bp insertion (AGCAAG) at the deletion site. (J:188991)