Gtf2ird2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTGCCCTAGATGAAGCTGG and CTAAACAGGCTGTCAGGCTC, which resulted in a 257 bp deletion beginning at Chromosome 5 position 134,196,365 bp and ending after 134,196,621 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001266451 (exon 5) and 73 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 117 and early truncation 2 amino acids later. (J:188991)