This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGATCTACAAACCCTAACG and GAGGAAAGTACACTTTTACA, which resulted in a 687 bp deletion beginning at Chromosome 10 position 43,884,488 bp and ending after 43,885,174 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001289085 and ENSMUSE00001281000 (exons 6,7) and 398 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 183 and early truncation 2 amino acids later. There is a single bp (C) insertion at the deletion site. (J:188991)