This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGGACCTTGGGAACAAGT and GATTCTATACATCCTTTCCA, which resulted in a 276 bp deletion beginning at Chromosome 2 position 120,283,707 bp and ending after 120,283,982 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000598028 (exon 3) and 139 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 48. (J:188991)