Peak1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTTACTGTACATAAAGACG and ACTTTTGAATACAAATTTGA, which resulted in a 250 bp deletion beginning at Chromosome 9 position 56,241,119 bp and ending after 56,241,368 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000352103 (exon 5) and 65 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 775 and early truncation 284 amino acids later. (J:188991)