P4ha3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCGCCTCCAAACACAGGCAA and CTTTGCTTGAGGTAATGACA, which resulted in a 403 bp deletion beginning at Chromosome 7 position 100,293,665 bp and ending after 100,294,067 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001265059 (exon 3) and 179 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 112 and early truncation 3 amino acids later. (J:188991)