This allele from project was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTAACCCTCAAACAACAGA and TTAGATGTTATCCTATCAAA, which resulted in a 659 bp deletion beginning at Chromosome 11 position 94,303,448 bp and ending after 94,304,106 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001287523 (exon 4) and 514 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 14 amino acids later. (J:188991)