Wfdc17^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAAGTGACTTCTCTCTAAT and CTAGAAGATCACTAGGACCA, which resulted in a 492 bp deletion beginning at Chromosome 11 position 83,703,768 bp and ending after 83,704,259 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000578061 (exon 1) and 309 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. (J:188991)