This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTGATTCCCGTCATACTG and GCGAGACTTGAGGGTTCGCA, which resulted in a 1228 bp deletion beginning at Chromosome 5 position 137,501,323 bp and ending after 137,502,550 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000686426 (exon 1) and 230 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. (J:188991)