This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCAGTTTCTAGCTGATAAC and GCTTCACCTGTGTTACACAG, which resulted in a 499 bp deletion beginning at Chromosome 19 position 57,370,946 bp and ending after 57,371,444 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000416995 (exon 3) and 329 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 42 amino acids later. (J:188991)