This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAAATAGCAAACCATCATAG and AGCAACCTCGAAGTTGACAC, which resulted in a 390 bp deletion beginning at Chromosome 4 position 45,301,069 bp and ending after 45,301,458 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000285934 (exon 3) and 275 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 61 and early truncation 10 amino acids later. (J:188991)